Week 0:::::Chromosome+Delirium+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
30 August
Amitav Ghosh, The Calcutta Chromosome

Week 1:::::Structure+Sign+Play+Nietzsche+Genealogy+History+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
6 September

Jacques Derrida, "Structure, Sign, and Play in the Discourse of the Human Sciences," Writing and Difference, trans. Alan Bass. London: Routledge, pp 278-294 at http://www.hydra.umn.edu/derrida/sign-play.html

Gilles Deleuze, "How Do We Recognize Structuralism?" over here, sorry about the size

Michel Foucault, “Nietzsche, Genealogy, History,” at http://www.thefoucauldian.co.uk/ngh.pdf

Semiotics for Beginners, especially 1-6, 9.

Joan Scott, "Fantasy Echo:History and the Construction of Identity," Critical Inquiry27(2):

If you really want to begin analysis with/of Lacan you should start with Shoshana Felman , but this is shorter and works OK and maybe all you care to know.


Week 2:::::FemaleMan+OncoMouse+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
13 September
Donna Haraway, Modest_Witness@Second_Millennium, 1-120

Michael M.J. Fischer, "Four Genealogies for a Recombinant Anthropology of Science and Technology" forthcoming in Cultural Anthropology


Week 3:::::Living+On+On+On+On+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
20 September

Jacques Derrida, "Living On: Borderlines"
Penelope Deutscher, How to Read Derrida
Richard Doyle, Wetwares! (University of Minnesota Press), Chapters 0-2.

Enough sur-vival -- we're on to pre-vival...

Week 4:::::DNA+Difference+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
27 September

Haraway, Modest Witness, 125-265
Michael J. Montoya, "Bioethnic Conscription"
Essays by Palmie, Abu el-Haj, Helmreich, Marks, and Weiss in American Ethnologist v. 34 n. 2 (2007).

(On a different but not unrelated note you can read a recent NYT article on Nadia Abu el-Haj's tenure case here
Fortun, "Race in the Meantime" ms. plus readers' reviews

Brief and smart biographing of Evelyn Fox Keller here.

Week 5:::::
Week 6:::::TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
11 October
NO CLASS -- 4S Meetings in Montreal

Week 7::::: Drive+Discourse+TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
4 October
Michel Foucault, History of Sexuality Vol. 1

Week 8:::::Guts+Feminism+DarwinTTAGGGTTAGGG
25 October
Elizabeth Wilson, "Gut Feminism", differences 15:3 (2004):66-94.
Elizabeth Wilson, "Biologically Inspired Feminism," http://english.arts.unsw.edu.au/downloads/staffpgs/ew_biologically.pdf
Elizabeth Grosz, Time Travels, Chapters 1-3, 12.
Interview with Terence Deacon

Week 9:::::Cell+Culture+TTAGGGTTAGGG
1 November
Hannah Landecker, Culturing Life


Week 10:::::Organ+Gift+Commodity+TTAGGGTTAGGGTTAGGG
18 October

THE GLOBAL TRAFFICIN HUMAN ORGANS: A Report Presented to the House Subcommittee on International Operations and Human Rights, United States Congress on June 27, 2001 by Nancy Scheper-Hughes
Deepa Reddy, "Good Gifts for the Common Good"
Doyle, Wetwares!, Chapter 8

8 November

Week 11:::::Life+Other+Wise+TTAGGGTTAGGG
15 November
Stefan Helmreich, "Trees and Seas of Information", American Ethnologist 30(3):340-358 (2003)
Stefan Helmreich, "After Culture: Reflections on the Apparaition of Anthropology in Artificial Life, a Science of Simulation", Cultural Anthropology 16(4):612-627.
Doyle, Wetwares, Chapter 9

Week 12:::::TTAGGG
22 November
NO CLASS -- THANKSGIVING

Week 13:::::TTAGGG
29 November
NO CLASS -- AAA Meetings

Week 14:::::WERANOUTOFTELOMERE...WEDEAD (unless of course we are more like slime mold than a cell)
6 December